DNA QUESTIONS
1 i) Describe the structure of a nucleotide and distinguish between a nucleotide and polynucleotide.
 

 

 

 

 

 

(5)

 ii) List THREE differences between DNA and RNA.
 

 

 

 

 

 

(3)

2 i) The following is the sequence of bases in one of the two strands of part of a DNA molecule  CAGGTACTG.  What will be sequence of bases in the complementary strand?
 

 

(1)

 ii) The following sequence of bases in DNA codes for the formation of a short peptide chain:  TACTTTAGAGGACCAGTAATT

(a) Show the sequence of bases you would expect to find in the corresponding messenger RNA molecule.
 

 

(1)

(b) Using the table below work out the resulting sequence of amino acids in the finished peptide chain? 

 

 

(1)
3 Lysozyme is a protein made up of 129 amino acids.
(a) How many DNA nucleotides are needed to encode for this chain of amino acids? 
 

 

(1)
(b) A complete turn of the DNA double helix contains 10 pairs of bases and is 3.4 nm long. What length of DNA molecule is occupied by the gene for lysozyme? 
 

 

(1)
(c) How many turns of the DNA double helix does this represent?
 

 

(1)