DNA QUESTIONS

1 i) Describe the structure of a nucleotide and distinguish between a nucleotide and polynucleotide.
Nucleotide is made up from
  • A ribose (or deoxyribose) sugar
  • A phosphate group (PO4)
  • An organic base (A,T,C,G &U)
  • Components held together with covalent bonds

Difference between a nucleotide and a polynucleotide

  • Nucleotide is a single unit / polynucleotide is made up of many nucleotides

(5)

 ii) List THREE differences between DNA and RNA.
  • DNA contains ribose sugar RNA contains deoxyribose
  • DNA contains base thymine RNA contains base uracil
  • DNA structure is double stranded RNA is single stranded
  • DNA can be thousands of nucleotides long RNA is usually only hundreds

(any 3)


2 i) The following is the sequence of bases in one of the two strands of part of a DNA molecule  CAGGTACTG.  What will be sequence of bases in the complementary strand?
  • GTCCATGAC

(1)

 ii) The following sequence of bases in DNA codes for the formation of a short peptide chain:  TACTTTAGAGGACCAGTAATT

(a) Show the sequence of bases you would expect to find in the corresponding messenger RNA molecule.

  • AUGAAAUCUCCUGGUCAUUAA

(1)

(b) Using the table below work out the resulting sequence of amino acids in the finished peptide chain? 

  • start/met,  lys, ser, pro, gly, his, stop

(1)


3 Lysozyme is a protein made up of 129 amino acids.
(a) How many DNA nucleotides are needed to encode for this chain of amino acids? 
  • 387

(1)

(b) A complete turn of the DNA double helix contains 10 pairs of bases and is 3.4 nm long. What length of DNA molecule is occupied by the gene for lysozyme? 
  • 131.6nm

NOTE no units no mark

(1)

(c) How many turns of the DNA double helix does this represent?
  • 38.7

(1)